Top » Catalog » SNPs » A10258

$18.00

A10258
[A10258]

A10258
HG19 Position: ChrY:21436630..21436630
Ancestral: T
Derived: C
Reference: William Hartley (2016)
ISOGG Haplogroup: I1
Comments: Downstream I-Z138 S6270+ S6275+
Forward Primer: A10258_F GACCTTTCCAGAGTCACTGACTG
Reverse Primer: A10258_R CTTTGCATTGAAATAACAAAAATTTC
Reviews

Customers who bought this product also purchased
A10259
A10259
A10257
A10257
A10255
A10255
A10254
A10254
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10520
1 x A11308
1 x A10627
1 x A10661
$72.00
Haplogroup Info
Other products
Currencies