Top » Catalog » SNPs » FGC44086

$18.00

FGC44086
[FGC44086]

FGC44086
hg38 Position: ChrY:16147363..16147363
Ancestral: C
Derived: T
Reference: Full Genomes (2016)
ISOGG Haplogroup: E1b (not listed)
Comments: Below V13. approx. L1019
Forward Primer: FGC44086_F CTACACATCTCTGTTAATGCTTTGC
Reverse Primer: FGC44086_R ATCATCCTTTTACTGATTGTACAACG
Reviews

Customers who bought this product also purchased
FGC44083
FGC44083
FGC19306
FGC19306
FGC14566
FGC14566
FGC45647
FGC45647
FGC14564
FGC14564
FGC45646
FGC45646
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies