Top » Catalog » SNPs » A10953

$18.00

A10953
[A10953]

A10953
HG19 Position: ChrY:15795701..15795701
Ancestral: T
Derived: C
Reference: Steve Fix (2016)
ISOGG Haplogroup: E1b (not listed)
Comments: Below Z5017 > S26015 > Z37530
Forward Primer: A10953_F GCAGGGGCTAGATATACTTGCC
Reverse Primer: A10953_R TGCAAGGATGATTCAGCAAG
Reviews

Customers who bought this product also purchased
Z37530
Z37530
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10106
$18.00
Haplogroup Info
Other products
Currencies