Top » Catalog » SNPs » A10959

$17.50

A10959
[A10959]

A10959
HG19 Position: ChrY:16714574..16714574
Ancestral: T
Derived: C
Reference: Zdenko Markovic (2016)
ISOGG Haplogroup: I2
Comments: Downstream A2512
Forward Primer: A10959_F CCTCAGGATTCGGTTTTCAG
Reverse Primer: A10959_R TTCTCCACCCACATGTGTTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies