Top » Catalog » SNPs » Y35

$18.00

Y35
[Y35]

Y35
hg38 Position: ChrY:13582778..13582778
Ancestral: G
Derived: A
Reference: Semargl (2013)
ISOGG Haplogroup: R1a1a1b1a2b3 (not listed)
Comments: Found from public sources
Forward Primer: Y35_F GCATGACTCTCCATTACCTCTTG
Reverse Primer: Y35_R CCCTACAAGCCTCTTTGCTG
Reviews

Customers who bought this product also purchased
YP613
YP613
Y2194
Y2194
YP6098
YP6098
BY27373
BY27373
YP3929
YP3929
Y2902
Y2902
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies