Top » Catalog » SNPs » A10949

$18.00

A10949
[A10949]

A10949
HG19 Position: ChrY:21302126..21302126
Ancestral: T
Derived: C
Reference: Alex Buchanan (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A10949_F TCTGACCAGATTGATTGGGG
Reverse Primer: A10949_R GGCTTAATTCTTATGCTTTTTGTTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10088
1 x A11644
1 x A11361
1 x A10658
1 x A10223
1 x A11119
$108.00
Haplogroup Info
Other products
Currencies