Top » Catalog » SNPs » A10960

$18.00

A10960
[A10960]

A10960
HG19 Position: ChrY:12835138..12835138
Ancestral: C
Derived: A
Reference: Peter Plant (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A10960_F ATGCTTGCACATCAAACCAC
Reverse Primer: A10960_R CAAGGTGTAGTGGCTCATGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10869
1 x A10748
1 x A10875
1 x A10586
1 x A10174
1 x A10874
1 x A10525
1 x A11124
$144.00
Haplogroup Info
Other products
Currencies