Top » Catalog » SNPs » A10963

$18.00

A10963
[A10963]

A10963
HG19 Position: ChrY:19498923..19498923
Ancestral: C
Derived: A
Reference: Peter Plant (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A10963_F AAACTAGCAGCCACCTCTGC
Reverse Primer: A10963_R AGATCAGCTCCTGCTTTTGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies