Top » Catalog » SNPs » A10965

$18.00

A10965
[A10965]

A10965
hg38 Position: ChrY:19983594..19983594
Ancestral: A
Derived: G
Reference: Peter Plant (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A10965_F GATTGATCACAAATGACGTAGGC
Reverse Primer: A10965_R TCAAAAGCCCATCACCTACC
Reviews

Customers who bought this product also purchased
A10964
A10964
Y22430
Y22430
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies