Top » Catalog » SNPs » A10971

$17.50

A10971
[A10971]

A10971
HG19 Position: ChrY:17263729..17263729
Ancestral: C
Derived: T
Reference: John Bower (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A10971_F TTGTTCTTGCCTTTAGTCCCAG
Reverse Primer: A10971_R CCGATCACTGGGAAGTCTTC
Reviews

Customers who bought this product also purchased
A10972
A10972
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies