Top » Catalog » SNPs » A10972

$18.00

A10972
[A10972]

A10972
HG19 Position: ChrY:21465672..21465672
Ancestral: G
Derived: A
Reference: John Bower (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A10972_F GAAAGTAAATCTTCTTCCTGCGG
Reverse Primer: A10972_R CCACATTCTATGTGCTCCTGC
Reviews

Customers who bought this product also purchased
A10971
A10971
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10943
1 x A11529
1 x A1146
1 x A11666
1 x A11682
1 x A10982
1 x A11243
1 x A11378
$144.00
Haplogroup Info
Other products
Currencies