Top » Catalog » SNPs » A10973

$18.00

A10973
[A10973]

A10973
HG19 Position: ChrY:7647634..7647634
Ancestral: A
Derived: G
Reference: Bruce Cockburn (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of R1b-L257_FGC15269_FGC15270
Forward Primer: A10973_F ACTGATCATCAGAGAAATGCAAAC
Reverse Primer: A10973_R TGATTTTGTTCTTTTTACAGCTGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies