Top » Catalog » SNPs » A10974

$18.00

A10974
[A10974]

A10974
HG19 Position: ChrY:17348198..17348198
Ancestral: C
Derived: A
Reference: Alex Buchanan (2016)
ISOGG Haplogroup: unknown
Comments: .
Forward Primer: A10974_F CTGATGTTGGGAATTAGGCTG
Reverse Primer: A10974_R GATAGTATGAGATGCTGCCCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies