Top » Catalog » SNPs » A10977

$18.00

A10977
[A10977]

A10977
HG19 Position: ChrY:16140538..16140538
Ancestral: T
Derived: C
Reference: Timo Rossi (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of L238
Forward Primer: A10977_F TTGAAAATCACACGTTGTTGC
Reverse Primer: A10977_R AAGCAAAACACCCCTGACTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A11619
1 x A10848
1 x A1146
1 x A1068
$72.00
Haplogroup Info
Other products
Currencies