Top » Catalog » SNPs » A10978

$18.00

A10978
[A10978]

A10978
HG19 Position: ChrY:17014598..17014598
Ancestral: G
Derived: T
Reference: Timo Rossi (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of L238
Forward Primer: A10978_F AATTTAGCTGGGCATGTTGG
Reverse Primer: A10978_R TTACAAGGTTGGCCCAAGAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies