Top » Catalog » SNPs » A11018

$17.50

A11018
[A11018]

A11018
HG19 Position: ChrY:7820047..7820047
Ancestral: A
Derived: G
Reference:
ISOGG Haplogroup: R1b (not listed)
Comments: Below DF21 > P314 > L362
Forward Primer: A11018_F TTCATGAGAATTATTATTGTGTATGTGC
Reverse Primer: A11018_R CTCACCTCTCCTCCTTGGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies