Top » Catalog » SNPs » A11085

$18.00

A11085
[A11085]

A11085
HG19 Position: ChrY:13225535..13225535
Ancestral: A
Derived: G
Reference: Richard Cameron (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of S695
Forward Primer: A11085_F GGCTCTTGGCAAACAGAAAC
Reverse Primer: A11085_R TTTCATCCCCTTCCTCCTTAC
Reviews

Customers who bought this product also purchased
A11092
A11092
A11090
A11090
A11088
A11088
A11087
A11087
A11086
A11086
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies