Top » Catalog » SNPs » A11085

$17.50

A11085
[A11085]

A11085
HG19 Position: ChrY:15337417..15337417
Ancestral: A
Derived: G
Reference: Richard Cameron (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of S695
Forward Primer: A11085_F GGCTCTTGGCAAACAGAAAC
Reverse Primer: A11085_R TTTCATCCCCTTCCTCCTTAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies