Top » Catalog » SNPs » A11086

$17.50

A11086
[A11086]

A11086
HG19 Position: ChrY:18026297..18026297
Ancestral: C
Derived: A
Reference: Richard Cameron (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of S695
Forward Primer: A11086_F CCAATATCCTCTTCCCAAAGG
Reverse Primer: A11086_R GCCAGGCTTGATCTTCTTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies