Top » Catalog » SNPs » A11087

$18.00

A11087
[A11087]

A11087
HG19 Position: ChrY:19197905..19197905
Ancestral: C
Derived: T
Reference: Richard Cameron (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of S695
Forward Primer: A11087_F GAAGTGTGGCCTCTTCAAGG
Reverse Primer: A11087_R TGCTTTGTAGACAAGCCTATTTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies