Top » Catalog » SNPs » A11088

$17.50

A11088
[A11088]

A11088
HG19 Position: ChrY:21676492..21676492
Ancestral: T
Derived: C
Reference: Richard Cameron (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of S695
Forward Primer: A11088_F GAGGCTATGCTGCAGTTTCC
Reverse Primer: A11088_R CAGGGCTCTGGTGATGTAGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies