Top » Catalog » SNPs » A11092

$18.00

A11092
[A11092]

A11092
HG19 Position: ChrY:7876883..7876883
Ancestral: T
Derived: C
Reference: Richard Cameron (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of S695
Forward Primer: A11092_F TCACTGGCTCAAACACAAGC
Reverse Primer: A11092_R GTGACACAATCCATGGGAAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies