Top » Catalog » SNPs » A11092

$18.00

A11092
[A11092]

A11092
hg38 Position: ChrY:8008842..8008842
Ancestral: T
Derived: C
Reference: Richard Cameron (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of S695
Forward Primer: A11092_F TCACTGGCTCAAACACAAGC
Reverse Primer: A11092_R GTGACACAATCCATGGGAAG
Reviews

Customers who bought this product also purchased
A11085
A11085
A11090
A11090
A11088
A11088
A11087
A11087
A11086
A11086
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies