Top » Catalog » SNPs » A11094

$18.00

A11094
[A11094]

A11094
HG19 Position: ChrY:16967487..16967487
Ancestral: G
Derived: T
Reference: Alex Buchanan (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A11094_F CTCCAGCTTGAGGAACACAAC
Reverse Primer: A11094_R AGGTGGGCAGATCATGAAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10123
1 x A10616
$36.00
Haplogroup Info
Other products
Currencies