Top » Catalog » SNPs » A10989

$18.00

A10989
[A10989]

A10989
HG19 Position: ChrY:8654261..8654261
Ancestral: G
Derived: A
Reference: Goff Blackburn (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream Z253 > A494 > A10980
Forward Primer: A10989_F ACCACGGAGACAACAGAAGG
Reverse Primer: A10989_R TATTCCTGGGGCTATGCTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10024
1 x A10999
1 x A10502
1 x A11017
1 x A11662
1 x A10856
1 x A10654
$126.00
Haplogroup Info
Other products
Currencies