Top » Catalog » SNPs » A10991

$18.00

A10991
[A10991]

A10991
HG19 Position: ChrY:9024933..9024933
Ancestral: T
Derived: C
Reference: Goff Blackburn (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream Z253 > A494 > A10980
Forward Primer: A10991_F GTAAGCTGTATTACCTTTTGCAGAAAG
Reverse Primer: A10991_R TCCAGCAGCCTGAGTTTATTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies