Top » Catalog » SNPs » A10994

$18.00

A10994
[A10994]

A10994
HG19 Position: ChrY:14395347..14395347
Ancestral: T
Derived: G
Reference: Goff Blackburn (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream Z253 > A494 > A10980
Forward Primer: A10994_F CAATGTTTATCATCCACACGC
Reverse Primer: A10994_R CTTCACTTCAGCAAGAATTATCTCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies