Top » Catalog » SNPs » A10995

$18.00

A10995
[A10995]

A10995
HG19 Position: ChrY:14636850..14636850
Ancestral: C
Derived: G
Reference: Goff Blackburn (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream Z253 > A494 > A10980
Forward Primer: A10995_F CATGCCCAGCCAACTACAG
Reverse Primer: A10995_R GAGAAACAAAGCAAGAACTGTCTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies