Top » Catalog » SNPs » A11001

$18.00

A11001
[A11001]

A11001
HG19 Position: ChrY:19673484..19673484
Ancestral: G
Derived: C
Reference: Goff Blackburn (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream Z253 > A494 > A10980
Forward Primer: A11001_F AGGCTTATCTGACCTGAAGTCC
Reverse Primer: A11001_R CAAAATATCACCTTCGGGATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies