Top » Catalog » SNPs » A11002

$18.00

A11002
[A11002]

A11002
HG19 Position: ChrY:20976029..20976029
Ancestral: G
Derived: A
Reference: Goff Blackburn (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream Z253 > A494 > A10980
Forward Primer: A11002_F ATTACACACTGGGGCCTGTC
Reverse Primer: A11002_R CCTTCACTATGCCATCATATGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1074
1 x A10144
1 x A11372
1 x A11686
1 x A10123
1 x A10950
1 x A1105
$126.00
Haplogroup Info
Other products
Currencies