Top » Catalog » SNPs » A11003

$18.00

A11003
[A11003]

A11003
HG19 Position: ChrY:21133292..21133292
Ancestral: G
Derived: A
Reference: Goff Blackburn (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream Z253 > A494 > A10980
Forward Primer: A11003_F CTTCAGCCCTTGTCTCCTTG
Reverse Primer: A11003_R ACGGCATGAGAAACACCTTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10624
1 x A10937
1 x A10685
1 x A10938
$72.00
Haplogroup Info
Other products
Currencies