Top » Catalog » SNPs » A11004

$17.50

A11004
[A11004]

A11004
HG19 Position: ChrY:23310866..23310866
Ancestral: C
Derived: T
Reference: Goff Blackburn (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream Z253 > A494 > A10980
Forward Primer: A11004_F TGCAAACAATCAGACCAAGC
Reverse Primer: A11004_R CCATGCTTTGTTGAGCTTCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies