Top » Catalog » SNPs » A11005

$18.00

A11005
[A11005]

A11005
HG19 Position: ChrY:21188967..21188967
Ancestral: A
Derived: T
Reference: Goff Blackburn (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream Z253 > A494 > A10980
Forward Primer: A11005_F CACTGCAAGCTCTGCCTTTC
Reverse Primer: A11005_R AACAAACAAAAACATGAACCAGAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10670
1 x A10933
1 x A11478
1 x A10949
1 x A10526
1 x A10028
1 x A10684
1 x A11706
$144.00
Haplogroup Info
Other products
Currencies