Top » Catalog » SNPs » A11007

$18.00

A11007
[A11007]

A11007
HG19 Position: ChrY:19770259..19770259
Ancestral: C
Derived: T
Reference: Goff Blackburn (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream Z253 > A494 > A10980
Forward Primer: A11007_F CAAGCAGAATTCACCAATCTGAG
Reverse Primer: A11007_R GTCTACCGTTAACCCGAAGGAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A11619
1 x A10848
1 x A1146
1 x A1068
1 x A10289
1 x A11618
$108.00
Haplogroup Info
Other products
Currencies