Top » Catalog » SNPs » A11009

$18.00

A11009
[A11009]

A11009
HG19 Position: ChrY:17097439..17097439
Ancestral: T
Derived: A
Reference: Goff Blackburn (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream Z253 > A494 > A10980
Forward Primer: A11009_F GTAACCACAATTAGGGAAAGCATG
Reverse Primer: A11009_R ATATCCCAATATTATGACAGTGCG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10303
1 x A10729
1 x A11005
$54.00
Haplogroup Info
Other products
Currencies