Top » Catalog » SNPs » A11010

$18.00

A11010
[A11010]

A11010
HG19 Position: ChrY:8530575..8530575
Ancestral: C
Derived: T
Reference: Goff Blackburn (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream Z253 > A494 > A10980
Forward Primer: A11010_F AGGCCTGATTGTGAGCTCTG
Reverse Primer: A11010_R AAGAGAACACCCCAGGGAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies