Top » Catalog » SNPs » A11015

$18.00

A11015
[A11015]

A11015
HG19 Position: ChrY:7889366..7889366
Ancestral: C
Derived: T
Reference: Goff Blackburn (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream Z253 > A494 > A10980
Forward Primer: A11015_F TGCTCAATGCCTCCATTAGTC
Reverse Primer: A11015_R AGGGTTAGGGCAATCCTTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10860
1 x A10530
1 x A10512
1 x A10026
$72.00
Haplogroup Info
Other products
Currencies