Top » Catalog » SNPs » A11016

$18.00

A11016
[A11016]

A11016
HG19 Position: ChrY:8800174..8800177
Ancestral: ins
Derived: del
Reference: Goff Blackburn (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream Z253 > A494 > A10980
Forward Primer: A11016_F TGAAGCCACTAAGAATGGTGAG
Reverse Primer: A11016_R AGGCCAAGACTCTCAGTTCATC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10683
1 x A11220
1 x A10997
1 x A10633
$72.00
Haplogroup Info
Other products
Currencies