Top » Catalog » SNPs » A11017

$18.00

A11017
[A11017]

A11017
HG19 Position: ChrY:2685043..2685043
Ancestral: G
Derived: A
Reference: Goff Blackburn (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream Z253 > A494 > A10980
Forward Primer: A11017_F TGTGGCCTCTAGGCATAAAATC
Reverse Primer: A11017_R TTCCTGAGAAGCAAGGTTGAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies