Top » Catalog » SNPs » A10982

$18.00

A10982
[A10982]

A10982
HG19 Position: ChrY:7693317..7693317
Ancestral: C
Derived: G
Reference: Goff Blackburn (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream Z253 > A494
Forward Primer: A10982_F TCAGAATCCTCACCTTTTCCTG
Reverse Primer: A10982_R GTTAAACCATTGGTAAGGTGATGTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies