Top » Catalog » SNPs » A10983

$18.00

A10983
[A10983]

A10983
HG19 Position: ChrY:7957235..7957235
Ancestral: C
Derived: G
Reference: Goff Blackburn (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream Z253 > A494
Forward Primer: A10983_F TGTGCCTCTCTCACTAATTGTCC
Reverse Primer: A10983_R TCAATGTTTTACCTCTTGAATTACCTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A11446
1 x A10673
1 x A1152
1 x A11017
1 x A11662
$90.00
Haplogroup Info
Other products
Currencies