Top » Catalog » SNPs » A10985

$18.00

A10985
[A10985]

A10985
HG19 Position: ChrY:17412310..17412310
Ancestral: G
Derived: A
Reference: Goff Blackburn (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream Z253 > A494
Forward Primer: A10985_F ATAGATGCCACATGGAACTGAG
Reverse Primer: A10985_R TTGTGAAAGCGATGTTACCG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10841
1 x A10662
$36.00
Haplogroup Info
Other products
Currencies