Top » Catalog » SNPs » A11096

$18.00

A11096
[A11096]

A11096
HG19 Position: ChrY:14781357..14781357
Ancestral: G
Derived: A
Reference: Zdenko Markovic (2016)
ISOGG Haplogroup: I2a1a1 (not listed)
Comments: Downstream of M26 > CTS12005
Forward Primer: A11096_F TGCAAAAGACTAGATCCTGGTG
Reverse Primer: A11096_R ATCGCATGACAGGAGGAAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10841
$18.00
Haplogroup Info
Other products
Currencies