Top » Catalog » SNPs » A11098

$16.00

A11098
[A11098]

A11098
HG19 Position: ChrY:9060351..9060351
Ancestral: C
Derived: T
Reference: Zdenko Markovic (2016)
ISOGG Haplogroup: I2
Comments: Downstream of M26
Forward Primer: A11098_F CAACAGTTTCTATGAACCAAGCTC
Reverse Primer: A11098_R TGCATTCCATTATCATTCTGAATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies