Top » Catalog » SNPs » Z640

$18.00

Z640
[Z640]

Z640
hg38 Position: ChrY:8342439..8342439
Ancestral: T
Derived: G
Reference: Bonnie Schrack (2011)
ISOGG Haplogroup: J1
Comments: Equivalent to or downstream from L147
Forward Primer: Z640_F CTTGATTACAAGGAGATTGTGAAATTC
Reverse Primer: Z640_R CATCTTGCACATGTTCTGGG
Reviews (1)

Customers who bought this product also purchased
FGC12309
FGC12309
ZS2010
ZS2010
ZS2006
ZS2006
FGC19909
FGC19909
FT79484
FT79484
FT93110
FT93110
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies