Top » Catalog » SNPs » Z640

$19.00

Z640
[Z640]

Z640
hg38 Position: ChrY:8342439..8342439
Ancestral: T
Derived: G
Reference: Bonnie Schrack (2011)
ISOGG Haplogroup: J1
Comments: Equivalent to or downstream from L147
Forward Primer: Z640_F CTTGATTACAAGGAGATTGTGAAATTC
Reverse Primer: Z640_R CATCTTGCACATGTTCTGGG
Reviews (1)

Customers who bought this product also purchased
ZS1488
ZS1488
FGC2012
FGC2012
FT305606
FT305606
FT55909
FT55909
FT309222
FT309222
FGC22316
FGC22316
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies