Top » Catalog » SNPs » A11099

$18.00

A11099
[A11099]

A11099
HG19 Position: ChrY:12226708..12226708
Ancestral: G
Derived: A
Reference: Richard McDevitt (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A11099_F CTGCTCATATCAATGTTTCACCC
Reverse Primer: A11099_R CATAAGGTCCTATTCCCATGTTCTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10569
1 x A11618
1 x A10763
1 x A10025
1 x A11697
1 x A10151
$108.00
Haplogroup Info
Other products
Currencies