Top » Catalog » SNPs » A11100

$17.50

A11100
[A11100]

A11100
HG19 Position: ChrY:15829130..15829130
Ancestral: C
Derived: G
Reference: Richard McDevitt (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A11100_F GCATATGCCATCTGAACTGG
Reverse Primer: A11100_R TGTATCGCCTGCTAGCCTTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies