Top » Catalog » SNPs » A11102

$18.00

A11102
[A11102]

A11102
HG19 Position: ChrY:16309957..16309957
Ancestral: G
Derived: T
Reference: Richard McDevitt (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A11102_F ACCCAGGAGGTGGAGGATAC
Reverse Primer: A11102_R ATTCAAATGCCCAAAGTTGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A11099
$18.00
Haplogroup Info
Other products
Currencies