Top » Catalog » SNPs » A11103

$17.50

A11103
[A11103]

A11103
HG19 Position: ChrY:23124005..23124005
Ancestral: G
Derived: T
Reference: Richard McDevitt (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A11103_F ATATGCTGGACCCTGTCTGC
Reverse Primer: A11103_R CATAGCGGGACTTTTTCTGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies