Top » Catalog » SNPs » A11103

$18.00

A11103
[A11103]

A11103
hg38 Position: ChrY:20962119..20962119
Ancestral: G
Derived: T
Reference: Richard McDevitt (2016)
ISOGG Haplogroup: R1b
Comments: M222 > DF105 > DF85 > S673 > DF97 > A11230
Forward Primer: A11103_F ATATGCTGGACCCTGTCTGC
Reverse Primer: A11103_R CATAGCGGGACTTTTTCTGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies